ID: 1092385562_1092385581

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1092385562 1092385581
Species Human (GRCh38) Human (GRCh38)
Location 12:8033461-8033483 12:8033512-8033534
Sequence CCAGCAGACAGAAAGAGCCCTCC GGGGAACTCCCCCAAGGGGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 240} {0: 1, 1: 0, 2: 0, 3: 10, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!