ID: 1092436727_1092436731

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1092436727 1092436731
Species Human (GRCh38) Human (GRCh38)
Location 12:8453449-8453471 12:8453489-8453511
Sequence CCATCCTGAAGCAGTCTTGGGGA ACGAGCATAGACACCAGGCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 255} {0: 1, 1: 0, 2: 0, 3: 7, 4: 107}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!