|
Left Crispr |
Right Crispr |
Crispr ID |
1092455072 |
1092455077 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:8635917-8635939
|
12:8635955-8635977
|
Sequence |
CCTAATCTCAAGTACACAGGGAC |
GGCCGCAGGGACCTCCGCCTAGG |
Strand |
- |
+ |
Off-target summary |
{0: 5, 1: 2057, 2: 786, 3: 107, 4: 166} |
{0: 2, 1: 397, 2: 1688, 3: 798, 4: 320} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|