ID: 1092471554_1092471559

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1092471554 1092471559
Species Human (GRCh38) Human (GRCh38)
Location 12:8786360-8786382 12:8786401-8786423
Sequence CCATCCAAGTTCAAAACCTAGCA AGACTCCATATTCCATATCCAGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 50, 3: 315, 4: 1039} {0: 1, 1: 0, 2: 3, 3: 64, 4: 607}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!