ID: 1092477141_1092477149

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1092477141 1092477149
Species Human (GRCh38) Human (GRCh38)
Location 12:8828950-8828972 12:8828997-8829019
Sequence CCCACAGTCACTGTGCTCTCCCG CTGTACCACAGTCACTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 11, 2: 57, 3: 117, 4: 318} {0: 1, 1: 0, 2: 0, 3: 21, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!