ID: 1092491612_1092491618

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1092491612 1092491618
Species Human (GRCh38) Human (GRCh38)
Location 12:8950227-8950249 12:8950279-8950301
Sequence CCTTTTTCCAGTTGAGTACCTTG TGTCGTTCCTTACTGCTTCGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 750} {0: 1, 1: 0, 2: 0, 3: 2, 4: 50}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!