ID: 1092510976_1092510980

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1092510976 1092510980
Species Human (GRCh38) Human (GRCh38)
Location 12:9156359-9156381 12:9156401-9156423
Sequence CCTTCCTCCATCTCTGGATCTTG CAGCGTGGCTGATGAGATCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 476} {0: 1, 1: 0, 2: 3, 3: 11, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!