ID: 1092615448_1092615454

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1092615448 1092615454
Species Human (GRCh38) Human (GRCh38)
Location 12:10212366-10212388 12:10212419-10212441
Sequence CCTGAGTCACGCTCTGTTTATGT CAAACACTGTGACGCCAGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 90} {0: 1, 1: 0, 2: 0, 3: 6, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!