ID: 1092651928_1092651930

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1092651928 1092651930
Species Human (GRCh38) Human (GRCh38)
Location 12:10644169-10644191 12:10644182-10644204
Sequence CCAGTAGGAACAGGGAGAAGGTG GGAGAAGGTGTGACTTTGAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 253} {0: 1, 1: 0, 2: 0, 3: 28, 4: 262}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!