ID: 1092677035_1092677040

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1092677035 1092677040
Species Human (GRCh38) Human (GRCh38)
Location 12:10931368-10931390 12:10931408-10931430
Sequence CCTCAAACTCAAAGACTCCCATT GAACACTCCTTGTTCAGGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 198} {0: 1, 1: 0, 2: 0, 3: 4, 4: 87}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!