ID: 1092712508_1092712516

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1092712508 1092712516
Species Human (GRCh38) Human (GRCh38)
Location 12:11353513-11353535 12:11353537-11353559
Sequence CCTGGAGGTGGGGGACCCTGAGG TTCTTGCCTCCTTGTGGGGGTGG
Strand - +
Off-target summary {0: 1, 1: 10, 2: 3, 3: 48, 4: 484} {0: 1, 1: 8, 2: 16, 3: 40, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!