ID: 1092818303_1092818309

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1092818303 1092818309
Species Human (GRCh38) Human (GRCh38)
Location 12:12330243-12330265 12:12330289-12330311
Sequence CCTACCTTCCCAGGAAGCAGTTT TTTGACATAGAAAGTGCAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 265} {0: 1, 1: 0, 2: 0, 3: 14, 4: 221}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!