ID: 1092871284_1092871288

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1092871284 1092871288
Species Human (GRCh38) Human (GRCh38)
Location 12:12808004-12808026 12:12808021-12808043
Sequence CCCTTCGACCTCTCCTTCTGGAG CTGGAGCCCATATATTGTTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 163} {0: 1, 1: 0, 2: 0, 3: 7, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!