ID: 1092908989_1092908992

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1092908989 1092908992
Species Human (GRCh38) Human (GRCh38)
Location 12:13128471-13128493 12:13128506-13128528
Sequence CCACAAAGTCTCATCTCCTGAAT GCGTGTGCATGTGCGTGCTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 258} {0: 1, 1: 0, 2: 4, 3: 45, 4: 290}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!