ID: 1092938541_1092938554

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1092938541 1092938554
Species Human (GRCh38) Human (GRCh38)
Location 12:13386314-13386336 12:13386349-13386371
Sequence CCTTCCTTGTTCCTTCTCCCCAG TCAGGGATAGGCCAATGGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 99, 4: 765} {0: 1, 1: 0, 2: 0, 3: 10, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!