ID: 1092968277_1092968279

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1092968277 1092968279
Species Human (GRCh38) Human (GRCh38)
Location 12:13666705-13666727 12:13666727-13666749
Sequence CCAGCTCTCATAAATAGGTATTG GTGGAGATACAGCCTGTGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 107} {0: 1, 1: 0, 2: 1, 3: 22, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!