ID: 1092972884_1092972888

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1092972884 1092972888
Species Human (GRCh38) Human (GRCh38)
Location 12:13715159-13715181 12:13715175-13715197
Sequence CCAAATTTAAAAATGACCTGACA CCTGACAGGGTGAATTATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 32, 4: 355} {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!