ID: 1093048919_1093048926

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1093048919 1093048926
Species Human (GRCh38) Human (GRCh38)
Location 12:14484946-14484968 12:14484995-14485017
Sequence CCACCAAAGCCCAGTTAACAGGC AGTTACCTGCAAAAGATGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 13, 4: 174} {0: 2, 1: 12, 2: 207, 3: 202, 4: 247}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!