ID: 1093079616_1093079623

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1093079616 1093079623
Species Human (GRCh38) Human (GRCh38)
Location 12:14794611-14794633 12:14794628-14794650
Sequence CCATACATCTGCACGACTTGAGG TTGAGGAGGAGGTGGACCAGGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 1, 3: 4, 4: 43} {0: 1, 1: 1, 2: 1, 3: 35, 4: 411}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!