ID: 1093108365_1093108367

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1093108365 1093108367
Species Human (GRCh38) Human (GRCh38)
Location 12:15117659-15117681 12:15117693-15117715
Sequence CCTCCATCACACACGCGCACACA ACACACACACACACAGTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 45, 3: 819, 4: 2833} {0: 7, 1: 48, 2: 1856, 3: 3889, 4: 7081}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!