ID: 1093393577_1093393582

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1093393577 1093393582
Species Human (GRCh38) Human (GRCh38)
Location 12:18652733-18652755 12:18652770-18652792
Sequence CCTTCAGGCTTTTTACATGTATA TACTAGAAACCTAATGAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 247} {0: 1, 1: 0, 2: 1, 3: 17, 4: 145}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!