ID: 1093456761_1093456765

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1093456761 1093456765
Species Human (GRCh38) Human (GRCh38)
Location 12:19372433-19372455 12:19372484-19372506
Sequence CCTTCCAGATTCTGGATATTAGT TTTCCTCCCATCCTGTTTTCTGG
Strand - +
Off-target summary {0: 1, 1: 42, 2: 1021, 3: 4375, 4: 5615} {0: 1, 1: 0, 2: 4, 3: 61, 4: 396}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!