ID: 1093621664_1093621668

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1093621664 1093621668
Species Human (GRCh38) Human (GRCh38)
Location 12:21297708-21297730 12:21297728-21297750
Sequence CCCTTGAAAGCTGAAGTCATAGC AGCAATGTTTTGGTGGCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 175} {0: 1, 1: 0, 2: 0, 3: 23, 4: 243}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!