ID: 1093643431_1093643435

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1093643431 1093643435
Species Human (GRCh38) Human (GRCh38)
Location 12:21554649-21554671 12:21554669-21554691
Sequence CCTGTCTGGAGTAGAGGAATGTG GTGTGTTAGGGAAAGGTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 35, 4: 753} {0: 1, 1: 0, 2: 0, 3: 20, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!