ID: 1093645726_1093645730

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1093645726 1093645730
Species Human (GRCh38) Human (GRCh38)
Location 12:21583647-21583669 12:21583681-21583703
Sequence CCATCTTCTGCAGATAACTACTC GAAAGCTCTTGGCCTGTTACTGG
Strand - +
Off-target summary {0: 178, 1: 192, 2: 102, 3: 110, 4: 247} {0: 1, 1: 173, 2: 203, 3: 145, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!