ID: 1094096128_1094096137

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1094096128 1094096137
Species Human (GRCh38) Human (GRCh38)
Location 12:26706834-26706856 12:26706885-26706907
Sequence CCTGTCAGTCATTCCTTTCACAA AATATTGTCTATGTATGATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 254} {0: 1, 1: 0, 2: 1, 3: 25, 4: 275}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!