ID: 1094120912_1094120913

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1094120912 1094120913
Species Human (GRCh38) Human (GRCh38)
Location 12:26973298-26973320 12:26973314-26973336
Sequence CCTTGGGAGCTGGGAGTAGGCAT TAGGCATGTGCCACCATGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 39, 4: 286} {0: 477, 1: 7714, 2: 31688, 3: 81374, 4: 150167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!