ID: 1094169955_1094169961

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1094169955 1094169961
Species Human (GRCh38) Human (GRCh38)
Location 12:27480821-27480843 12:27480863-27480885
Sequence CCATGCCTGTACAGCTTACAGAA TCTTTTCTTTATAAATTACCTGG
Strand - +
Off-target summary {0: 1, 1: 3, 2: 63, 3: 401, 4: 660} {0: 134, 1: 304, 2: 394, 3: 368, 4: 1003}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!