ID: 1094173676_1094173681

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1094173676 1094173681
Species Human (GRCh38) Human (GRCh38)
Location 12:27520942-27520964 12:27520964-27520986
Sequence CCCAAGACACCCAGAGGCCAGTG GATTTCAGTATGTTTATTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 263} {0: 1, 1: 0, 2: 0, 3: 41, 4: 459}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!