ID: 1094316702_1094316707

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1094316702 1094316707
Species Human (GRCh38) Human (GRCh38)
Location 12:29144205-29144227 12:29144243-29144265
Sequence CCCAAGGATGTAAAACAAGATGG CTCGTTACTGACCAGTTTGCTGG
Strand - +
Off-target summary {0: 6, 1: 26, 2: 81, 3: 125, 4: 249} {0: 1, 1: 1, 2: 12, 3: 49, 4: 132}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!