ID: 1094325347_1094325352

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1094325347 1094325352
Species Human (GRCh38) Human (GRCh38)
Location 12:29232006-29232028 12:29232023-29232045
Sequence CCTATGAAATTGAAAAAGAACAT GAACATATCTCAAAGGGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 5, 3: 49, 4: 744} {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!