ID: 1094333349_1094333354

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1094333349 1094333354
Species Human (GRCh38) Human (GRCh38)
Location 12:29320593-29320615 12:29320643-29320665
Sequence CCAAGACTGGTTAACTACAAATC GTAGCTAAAAGACCTAGGTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 116} {0: 1, 1: 0, 2: 0, 3: 5, 4: 97}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!