ID: 1094346758_1094346761

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1094346758 1094346761
Species Human (GRCh38) Human (GRCh38)
Location 12:29478586-29478608 12:29478615-29478637
Sequence CCTTAACCCTTCTAGAAGGGAAA TAAGATAAGATCATTGCCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 191} {0: 1, 1: 0, 2: 1, 3: 15, 4: 142}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!