ID: 1094369687_1094369691

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1094369687 1094369691
Species Human (GRCh38) Human (GRCh38)
Location 12:29724534-29724556 12:29724568-29724590
Sequence CCATTATCCAACTTACACAGCAT TTACACAGCTGGGAAATGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 146} {0: 1, 1: 0, 2: 14, 3: 46, 4: 381}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!