ID: 1094371029_1094371036

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1094371029 1094371036
Species Human (GRCh38) Human (GRCh38)
Location 12:29737675-29737697 12:29737700-29737722
Sequence CCTCTACAGCCTGGGGCAGCCTA TGGTGGAATCAGATGGATGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 308} {0: 1, 1: 0, 2: 0, 3: 15, 4: 227}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!