ID: 1094459707_1094459709

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1094459707 1094459709
Species Human (GRCh38) Human (GRCh38)
Location 12:30682138-30682160 12:30682159-30682181
Sequence CCAGCTTATTATATCTCATATTT TTTGGTTACCATATCCTGAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 431} {0: 1, 1: 0, 2: 2, 3: 6, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!