ID: 1094486879_1094486882

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1094486879 1094486882
Species Human (GRCh38) Human (GRCh38)
Location 12:30932634-30932656 12:30932665-30932687
Sequence CCTGTTTGTGTGAGGGAGTCACA TGGAGATCTACTAAAACCTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 140} {0: 1, 1: 0, 2: 1, 3: 6, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!