ID: 1094508532_1094508535

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1094508532 1094508535
Species Human (GRCh38) Human (GRCh38)
Location 12:31081887-31081909 12:31081900-31081922
Sequence CCTTAGGAACTTCCTCAGCTCAC CTCAGCTCACTTTCAAATGGAGG
Strand - +
Off-target summary {0: 3, 1: 0, 2: 1, 3: 10, 4: 154} {0: 3, 1: 0, 2: 1, 3: 17, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!