ID: 1094800068_1094800077

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1094800068 1094800077
Species Human (GRCh38) Human (GRCh38)
Location 12:34022778-34022800 12:34022792-34022814
Sequence CCCCAACCTGTCCCCACCCCAGG CACCCCAGGAGAGGCCTGAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 91, 4: 772} {0: 1, 1: 1, 2: 0, 3: 38, 4: 291}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!