ID: 1095121507_1095121508

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1095121507 1095121508
Species Human (GRCh38) Human (GRCh38)
Location 12:38424854-38424876 12:38424871-38424893
Sequence CCTCTCAAAAAGAGAGTAGTTTT AGTTTTCTGCAGAAAATGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 9, 3: 41, 4: 246} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!