ID: 1095154967_1095154971

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1095154967 1095154971
Species Human (GRCh38) Human (GRCh38)
Location 12:38841838-38841860 12:38841857-38841879
Sequence CCTGTGACTTCCTTTCCACAGGG AGGGAGAAGCAGAAAGATGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 277} {0: 1, 1: 1, 2: 10, 3: 141, 4: 1278}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!