ID: 1095186760_1095186762

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1095186760 1095186762
Species Human (GRCh38) Human (GRCh38)
Location 12:39209304-39209326 12:39209328-39209350
Sequence CCTTCAGGACATTATCCAGGAGA CTTCCCCAACCTAGCGAGACAGG
Strand - +
Off-target summary {0: 1, 1: 41, 2: 64, 3: 48, 4: 216} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!