ID: 1095245282_1095245286

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1095245282 1095245286
Species Human (GRCh38) Human (GRCh38)
Location 12:39912519-39912541 12:39912556-39912578
Sequence CCTAATATGGATAGAAAAGTTAT CAGTAGCCACAGATTAGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 283} {0: 1, 1: 0, 2: 1, 3: 16, 4: 169}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!