ID: 1095267764_1095267769

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1095267764 1095267769
Species Human (GRCh38) Human (GRCh38)
Location 12:40180303-40180325 12:40180325-40180347
Sequence CCTTAAAAACTCTGCTCCCCTAA ATGCTCAGAAAGACTGATTTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!