ID: 1095324848_1095324850

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1095324848 1095324850
Species Human (GRCh38) Human (GRCh38)
Location 12:40877052-40877074 12:40877084-40877106
Sequence CCAAAATAATTGTGAGTATGAAC TGTGAGCTTCTTGAACAAGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 270} {0: 1, 1: 0, 2: 1, 3: 14, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!