ID: 1095364992_1095364997

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1095364992 1095364997
Species Human (GRCh38) Human (GRCh38)
Location 12:41392598-41392620 12:41392646-41392668
Sequence CCCCTTACTTACATCCTAGTTAT TATCACCTATTGAATCCTATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 196} {0: 1, 1: 0, 2: 1, 3: 4, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!