|
Left Crispr |
Right Crispr |
Crispr ID |
1095444983 |
1095444989 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
12:42274015-42274037
|
12:42274032-42274054
|
Sequence |
CCACACCCACCCGGAACTCCAGC |
TCCAGCTGGCCCGCAAGCACTGG |
Strand |
- |
+ |
Off-target summary |
{0: 27, 1: 491, 2: 428, 3: 499, 4: 809} |
{0: 2, 1: 13, 2: 9, 3: 26, 4: 135} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|