ID: 1095587382_1095587394

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1095587382 1095587394
Species Human (GRCh38) Human (GRCh38)
Location 12:43863930-43863952 12:43863977-43863999
Sequence CCGGCGCTTGCGGGCCAGCTAGA GGCCCCACACTCGGAGCTGCCGG
Strand - +
Off-target summary {0: 1, 1: 13, 2: 14, 3: 14, 4: 57} {0: 1, 1: 61, 2: 377, 3: 487, 4: 521}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!