ID: 1095658518_1095658521

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1095658518 1095658521
Species Human (GRCh38) Human (GRCh38)
Location 12:44700088-44700110 12:44700115-44700137
Sequence CCTAAGTGAGCAGCACCAACATC TATTTATTAGTCCAGAAACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 226} {0: 1, 1: 0, 2: 0, 3: 10, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!