ID: 1095675196_1095675200

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1095675196 1095675200
Species Human (GRCh38) Human (GRCh38)
Location 12:44908595-44908617 12:44908642-44908664
Sequence CCCACATGGACATTAAAATATTT GGATGAAATTAAAGTGATCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 52, 4: 508} {0: 1, 1: 0, 2: 2, 3: 9, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!